XXVI : 1234

626 39 4
                                    

─── A Z U R A ───

Tutok na tutok siya sa pag dedecode ng mga code na bigay ni Unknownimous kaya pati ako'y nakigaya narin. Bumukas ang pinto ng clubroom at iniluwa nun ang papasok na sina Roux, Sienna, Viridian at Cole. Nang mapansin nila kami ay nakiupo rin sila sa couch at tinignan ang papel at card na nasa mesa.

"What's that?" pambungad na tanong ni Sienna sabay upo sa tabi ko.

"Mas nakakatakot pa yata 'yan kaysa sa math equation" komento ni Cole habang nakatingin sa mga nakasulat.

"Both message comes from Unknownimous. Sino kaya ang tao sa likod ng codename na 'yan?" Viridian looked so curious as to what is the identity of the sender.

"Hey code master, can you decode this?" tanong ni Cerl kay Roux sabay turo sa mga card at papel na nakalatag sa mesa.

Lumapit si Roux sa mesa at tinignan ang mga papel after a couple of minutes he spoke.

"I know your club's secret" Roux muttered as his gaze was fixed in the paper.

"Huh?" napakunot noong tanong ni Sienna.

"The answer in the first code is I know your club's secret" paglilinaw ni Roux sabay tingin sa amin.

"How about the other one?" Viridian queried.

"It says, Detective Club" Roux answered while jerking his thumb in the card.

Mukhang nabahala silang lahat ng malaman ang hidden message ng code na ipinadala sa amin ni Unknownimous. Whoever he or she is, malamang masaya siyang nakikita kami ngayong problematic.

"Don't you think its a prank?" I break the silence.

"It isn't Azura. Napaka-extraordinary namang prank neto pag nagkataon" ani Cole while leaning his back in the couch.

"Nakakapagtaka lang na may iba pang nakakaalam ng secret natin maliban sa atin at kay Yohan" nakasimangot na sabi ni Sienna.

"Shall we consider this as a form of threatening?" Viridian said.

"Unknownimous is trying to threaten us so that we'll stop doing detective stuff" Cerl said habang nakalumbaba.

"Roux, how did you come up with such answers?" I divert the topic.

(1)

Let's Dance!
Step forward, sideward and?

HJMNVXNTQBKTARRDBQDS

-Unknownimous

"Let's start with the first code, as you can see ang wala lang sa mga steps ay backward. Unknownimous used the Step Backward Code or Atbash. The letter A in this code is equivalent to Z. Dahil nga pa-backward siya kung ano ang letter before that ay ang siyang ilalagay. Like for example 'yung sa code, the letter which comes before I is H kaya 'yun ang nakalagay. Before K is J, and so on and so forth" pagpapaliwanag niya habang dine-demonstrate sa amin kung papaano ito kinukuha.

H J M N V X N T Q B K T A R R D B Q D S
I  K N O W Y O U R C L U B S S  E C R E T

"E 'yung pangalawa?" Sienna asked.

(2)

What's your DNA?

CTCACACATACAAAGCATAGACCCACATTGCTAAGTCCAAAC

-Unknownimous

CODEPLAY | #Wattys2021Tahanan ng mga kuwento. Tumuklas ngayon